Alm lab Protocol for processing overlapping 16S rRNA reads from a MiSeq run
Experimental design
The specifics of the sequencing set-up and molecular construct will determine exactly how the data needs to be sequenced and processed. There are a few different designs that the Alm lab has set up:
1.) (Standard) Multiplexing different samples together to be sequenced in one lane of Illumina, marking each unique sample with a unique barcode on the reverse primer of step 2 that is read during the indexing read. This is common for up to 96 samples (or 105 including additional barcodes that are not in the 96-well format). The sequencing should be done, not with the standard Illumina indexing primer, but with the reverse complement of the 2nd read sequencing primer. This is a custom barcode that should be included in the sequencing set-up. See sequencing section below for protocol.
2.) Multiplexing multiple different plates of samples together using a barcode located 5' to the primer used in genome amplification (typically U515) and a reverse barcode that is read during the indexing read. This is not typical for the Alm lab MiSeq protocol, since getting only about 12-25 million reads from MiSeq is sufficient for about 100 samples, not more. However, it is a possible scenario for samples which do not require high coverage.
3.) Mixing both genome sequencing and 16S rRNA amplicon sequencing together in one lane. Adding genome library preps to 16S amplicon lanes improves the quality of the base calling by adding diversity without loosing much to phiX sequencing. The genome library constructs typically contain barcodes in the forward and reverse read sequences, and do not typcially have an indexing read associated with them. However, adding them to a lane which does have a index read is ok.
4.) An experimental set-up using both forward and reverse orientation of the 16S rRNA among different samples, and staggering the diversity region 5' of both primers used in genome amplification allows for sufficient base diversity to run 16S rRNA libraries without wasting phiX data. In this case, half of the samples begin by sequencing from the U515 primer in the forward read, and half begin by sequencing from the U786 from the forward read. Additionally, the number of bases before the primer sequence varies from 4-9 bp.
Sequencing
Sequencing our construct on MiSeq is slightly different than standard Illumina MiSeq sequencing. Load the providedsample sheet, (which arbitrarily specifies a 250 paired-end run with an 8nt barcode read) and spike in 15uL of the anti-reverse BMC index primer @ 100uM (5' AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG 3') into tube 13 of the cartridge. This should provide three reads (forward, reverse and index) at 250, 8, 250 bp each.
De-multiplexing
Depending on whether your samples contains data from other projects that you don not want to process, you can demultiplex at various stages. Typically if there are multiple un-related projects in the same run, I will pull out all of the reads that map to the specific barcodes I am interested in first, so that I don't have to process extra data. You also have the option of removing unwanted barcodes at the qiime: split_libraries_fastq.py step by providing a mapping file containing only the barcodes you want. This makes sense if you if you will eventually work with all of the data, but in sets. Otherwise, if you will never need to work with the other data in the lane, it doesn't make sense to process it at all.
Run this program to parse out sequences from the raw data according to the following order:
1.) Single barcodes that are unique in the sample. These are possibly control samples or extra barcodes that were done uniquely and are the only piece of information indicating which samples that sequence came from
2.) Next, it looks for the presence of the forward and reverse barcodes in the forward and reverse read. These are typically from genome sequences.
3.) Finally, it looks for paired data, pulling out reads that have both the forward barcode and the indexing barcodes that match input samples.
All other samples that do not match are discarded.
Program:
parse_Illumina_multiplex2.pl <Solexa File1> <Solexa File2> <mapping> <output_prefix>
<mapping> input file should have the following fields (tab delimited, here's an example file):
Barcode construction, output name, forward barcode name, forward barcode seq, forward barcode orientation, index barcode name, index barcode seq, index barcode orientation, reverse barcode name, reverse barcode seq, reverse barcode orientation
Samples with the same output name will be in the same file. Barcode construction must be one of the following exact fields: single, double or forbar. Use single for option 1 above (single barcodes identify the samples), the 2
The output should be forward and reverse files labeled output_prefix.output_name.1 and output.2 respectively.
These can be used as the fastq files in downstream processes.