Expression Levels in Cell Lines
Presursor | Mature | Regulation | miRNA Sequence | miRNA Target Sequence | ttest rawp | article |
hsa-mir-144 | hsa-miR-144-5p | Down | GGAUAUCAUCAUAUACUGUAAG | CUUACAGUAUAUGAUGAUAUCC | 2.91772E-08 | A blood based 12-miRNA signature of Alzheimer disease patients |
hsa-mir-30d | hsa-miR-30d-5p | Up | UGUAAACAUCCCCGACUGGAAG | CUUCCAGUCGGGGAUGUUUACA | 8.17041E-14 | A blood based 12-miRNA signature of Alzheimer disease patients |
hsa-let-7f-1 | hsa-let-7f-5p | Up | UGAGGUAGUAGAUUGUAUAGUU | AACUAUACAAUCUACUACCUCA | 1.39318E-07 |
http://www.ncbi.nlm.nih.gov/pubmed/24858274
MicroRNA1 | Alzheimer Disease Affected Tissue | Aging Model | Reference | ||||
---|---|---|---|---|---|---|---|
Cortex | Hippocampus | Cerebellum | CSF | PBMC | |||
Down-Regulated | |||||||
let-7i | ↓ | ↓ | [96,169] | ||||
miR-9 | ↓ | ↓ | ↓ | [99, 96] | |||
miR-15 | ↓ | ↓ | [99, 96] | ||||
miR-146b | ↓ | ↓ | ↓ | ↓ | [99] | ||
miR-181c | ↓ | ↓ | [99, 96] | ||||
miR-210 | ↓ | ↓ | [99, 96] | ||||
miR-338 | ↓ | ↓ | [99, 96] | ||||
miR-451 | ↓ | ↓ | [99, 169] | ||||
Up-Regulated | |||||||
let-7f | ↑ | ↑ | ↑ | [99, 39, 181] | |||
miR-30d | ↑ | ↑ | [99, 169] | ||||
miR-34a | ↑ | ↑ | ↑ | ↑ | ↑ | [39, 99, 169, 170] | |
miR-125b | ↑ | ↑ | ↑ | [99, 98] | |||
miR-197 | ↑ | ↑ | [99, 96] | ||||
miR-200a | ↑ | ↑ | [99, 39] | ||||
miR-371 | ↑ | ↑ | [99, 39] | ||||
miR-517 | ↑ | ↑ | ↑ | [99, 39] | |||
miR-520h | ↑ | ↑ | [96, 39] |
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2705849/
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2705849/
http://genomebiology.com/2013/14/7/R78
Order? | R |
---|---|
-34a | U |
-146a | U |
let-7f | U |
-9 | D |
-146a | D |
-181c | D |
-106a/b | D |
-107 | D |
-29a/b | D |
Up-Regulated | Down-Regulated | ||||||||||
brain-miR-112 | hsa-miR-107 | ||||||||||
brain-miR-161 | hsa-miR-103a-3p | ||||||||||
hsa-miR-26a-5p | hsa-miR1-532-5p | ||||||||||
hsa-miR-5010-3p | hsa-miR-26b-5p | ||||||||||
hsa-miR-1285-5p | hsa-let-7f-5p | ||||||||||
hsa-miR-151a-3p | |||||||||||
hsa-let-7d-3p | |||||||||||
THE FINAL REAL miRNA PROFILE | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
hsa-miR-30d-5p | It's the most up regulated | A blood based 12-miRNA signature of Alzheimer disease patients | |||||||||
hsa-miRlet-1447f-5p | It's the most down regulated | A blood based 12-miRNA signature of Alzheimer disease patients2 | 3.90488E-07 | ||||||||
hsa-let7f-5p | it's upregulated, and it shows up a lot | A blood based 12-miRNA signature of Alzheimer disease patients | mir-125b-1 | hsa | has-miR-125b | up regulated in response to oxidative damage-5p | Up | UCCCUGAGACCCUAACUUGUGA | UCACAAGUUAGGGUCUCAGGGA | 0.318894647 | Studying micro RNA function and dysfunction in Alzheimer’s disease |
hsa-mir-125b-2 | 0.313925311 | ||||||||||
hsa-mir-146a | hsa | has-miR-146a | greatest up regulation as part of neuroinflamation-5p | Up | UGAGAACUGAAUUCCAUGGGUU | AACCCAUGGAAUUCAGUUCUCA | 0.675302536 | Studying micro RNA function and dysfunction in Alzheimer’s disease | has|||
hsa- | miRmir-181c | down regulated by Aβ-42 | Target gene repression mediated by miRNAshsa-miR-181c | and miR-9 both of which are down-regulated by amyloid-βhas-miR-9 | down regulated by Aβ-42-5p | Down | AACAUUCAACCUGUCGGUGAGU | ACUCACCGACAGGUUGAAUGUU | 0.884865736 | Target gene repression mediated by miRNAs miR-181c and miR-9 both of which are down-regulated by amyloid-β |